ViJEEta
Join free
Menu
NEET UG · BotanyUpdated 19 Oct 2026

NEET Botany PYQs and chapter-wise weightage

NEET UG Botany covers 21 chapters with 793 tagged previous-year questions and 6,374 calibrated questions in the ViJEEta bank. Every chapter is ranked below by its share of its subject's tagged NEET PYQs in the bank (NEET 2013–2026; repeated questions counted once). ★ is exam importance by that share, not difficulty.

Take a 25-Q NEET chapter testTry 180-row NEET OMR demoCompare all NEET subjects

Answer right here with no sign-in

Q1BotanyNEET UG PYQTranscription
Try right here · No sign-in
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows: 5′ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3′?
Answer key (B) & worked solution

Correct answer: Option B

5′ ATCGATCGATCGATCGATCGATCGATCG 3′
Q2BotanyNEET UG PYQProperties of Genetic Material (DNA Versus RNA)
Try right here · No sign-in
Given below are two statements: Statement I: In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes, RNA acts as a genetic material and also as a catalyst for some important biochemical reactions in living systems. Being reactive, RNA is unstable. Statement II: DNA evolved from RNA and is a more stable genetic material. Its double helical strands being complementary, resist changes by evolving repairing mechanism. In the light of the above statements, choose the most appropriate answer from the options given below:
Answer key (C) & worked solution

Correct answer: Option C

The first statement correctly explains RNA being the first genetic material as well as being unstable due to its single stranded nature. The second statement is correct as well as DNA evolved from RNA as a more stable double stranded genetic material.
Q3BotanyNEET UG PYQThe Search for Genetic Material
Try right here · No sign-in
Transformation was discovered by:
Answer key (B) & worked solution

Correct answer: Option B

Transformation is the genetic alteration of a cell resulting from the direct uptake and incorporation of exogenous genetic material from its surroundings and taken up through the cell membrane. Transformation was first demonstrated in 1928 by British bacteriologist Frederick Griffith.

Botany chapters ranked by measured NEET weight

#ChapterWeight (/100 of Botany)Exam importance (★)PYQ countPractice poolAction
1Molecular Basis of Inheritance9.1★★★★★72588PYQs & test →
2Cell: The Unit of Life8.1★★★★★64524PYQs & test →
3Morphology of Flowering Plants7.9★★★★★63591PYQs & test →
4Principles of Inheritance and Variation7.9★★★★★63525PYQs & test →
5Biological Classification7.1★★★★★56606PYQs & test →
6Cell Cycle and Cell Division6.4★★★★☆51451PYQs & test →
7Sexual Reproduction in Flowering plants6.4★★★★☆51543PYQs & test →
8Biodiversity and Its Conservation5.3★★★★☆42477PYQs & test →
9Ecosystem4.7★★★★☆37393PYQs & test →
10Organisms and Populations4.7★★★★☆37304PYQs & test →
11Anatomy of Flowering Plants4.5★★★★☆36481PYQs & test →
12Photosynthesis in Higher Plants4.3★★★☆☆34483PYQs & test →
13Plant Growth and Development4.0★★★☆☆32406PYQs & test →
14Environmental Issues3.9★★★☆☆3148PYQs & test →
15Plant Kingdom3.7★★★☆☆29507PYQs & test →
16Respiration in Plants2.5★★★☆☆20426PYQs & test →
17Strategies for Enhancement in Food Production2.1★★☆☆☆17133PYQs & test →
18Transport in Plants2.0★★☆☆☆16110PYQs & test →
19Mineral Nutrition1.9★★☆☆☆15134PYQs & test →
20The Living World1.9★★☆☆☆15319PYQs & test →
21Reproduction in Organisms1.5★★☆☆☆1264PYQs & test →