Updated 19 Oct 2026

Practise the NEET OMR sheet online (playable demo)

In the NEET UG exam hall, a darkened OMR bubble cannot be erased. Read the 6 real NEET previous-year questions in the test booklet on the left and darken the matching ① ② ③ ④ bubbles on the pink OMR response sheet on the right. When Strict OMR Mode is ticked, a filled navy bubble (#1B2A4A) is permanently locked.

TEST BOOKLET CODE: M1NEET (UG) · +4, −1

Q.001 · Physics

As the temperature increases, the electrical resistance:

(1) Increases for both conductors and semiconductors

(2) Decreases for both conductors and semiconductors

(3) Increases for conductors but decreases for semiconductors

(4) Decreases for conductors but increases for semiconductors

Q.002 · Physics

For transistor action, which of the following statements is correct ?

(1) Both emitter junction as well as the collector junction are forward biased.

(2) The base region must be very thin and lightly doped.

(3) Base, emitter and collector regions should have same doping concentrations.

(4) Base, emitter and collector regions should have same size.

Q.003 · Chemistry

Predicted the correct order of repulsion among the following :

(1) lone pair-bond pair > bond pair-bond-pair > lone pair - lone pair

(2) lone pair-lone pair > lone pair-bond pair > bond pair – bond pair

(3) lone pair-lone pair > bond pair-bond pair > lone pair-bond pair

(4) bond pair-bond pair > lone pair-bond pair > lone pair- lone pair

Q.004 · Chemistry

Which of the following are paramagnetic? A. [NiCl

_{4}

]2– B. Ni(CO)

_{4}

C. [Ni(CN)

_{4}

]2– D. [Ni(H

_{2}

_{6}

]

^{2}

^{+}

E. Ni(PPh

_{3}

)

_{4}

Choose the correct answer from the options given below:

(1) A and D only

(2) A, D and E only

(3) A and C only

(4) B and E only

Q.005 · Botany

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows: 5′ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3′?

(1) 3′ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5′

(2) 5′ ATCGATCGATCGATCGATCGATCGATCG 3′

(3) 3′ ATCGATCGATCGATCGATCGATCGATCG 5′

(4) 5′ UAGCUAGCUAGCUAGCUAGCUAGC UAGC 3′

Q.006 · Zoology

Plasmid pBR322 has a PstI restriction enzyme site within gene amp

^{R}

that confers ampicillin resistance. If this enzyme is used for inserting a gene for β-galactoside production and the recombinant plasmid is inserted in an E.coli strain

(1) It will lead to lysis of the host cell

(2) It will be able to produce a novel protein with dual ability

(3) It will not be able to confer ampicillin resistance to the host cell

(4) The transformed cells will have the ability to resist ampicillin as well as produce β-galactoside

Check the official keys and explanations

Q1PhysicsNEET UG PYQResistivity of Various Materials

As the temperature increases, the electrical resistance:

AIncreases for both conductors and semiconductors

BDecreases for both conductors and semiconductors

CIncreases for conductors but decreases for semiconductors

DDecreases for conductors but increases for semiconductors

Answer key (D) & worked solution

Correct answer: Option D

As temperature increases, the resistance increases for conductors, but decreases for semi-conductors.

Q2PhysicsNEET UG PYQP-N Junction

For transistor action, which of the following statements is correct ?

ABoth emitter junction as well as the collector junction are forward biased.

BThe base region must be very thin and lightly doped.

CBase, emitter and collector regions should have same doping concentrations.

DBase, emitter and collector regions should have same size.

Answer key (B) & worked solution

Correct answer: Option B

For a transistor action, the base junction must be lightly doped so that the base region is very thin.

Q3ChemistryNEET UG PYQVSEPR Theory

Predicted the correct order of repulsion among the following :

Alone pair-bond pair > bond pair-bond-pair > lone pair - lone pair

Blone pair-lone pair > lone pair-bond pair > bond pair – bond pair

Clone pair-lone pair > bond pair-bond pair > lone pair-bond pair

Dbond pair-bond pair > lone pair-bond pair > lone pair- lone pair

Answer key (B) & worked solution

Correct answer: Option B

The order of repulsion force according to VSEPR theory : lone pair-lone pair > lone pair-bond pair > bond pair – bond pair

Q4ChemistryNEET UG PYQVBT Theory in Coordination Compounds

Which of the following are paramagnetic? A. [NiCl

_{4}

]2– B. Ni(CO)

_{4}

C. [Ni(CN)

_{4}

]2– D. [Ni(H

_{2}

_{6}

]

^{2}

^{+}

E. Ni(PPh

_{3}

)

_{4}

Choose the correct answer from the options given below:

AA and D only

BA, D and E only

CA and C only

DB and E only

Answer key (A) & worked solution

Correct answer: Option A

A. [NiCl

_{4}

]2– = Ni

^{2 +}

is 3d

^{8}

paramagnetic D. [Ni(H

_{2}

_{6}

]

^{2 +}

= Ni

^{2 +}

is 3d

^{8}

paramagnetic

Q5BotanyNEET UG PYQTranscription

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows: 5′ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3′?

A3′ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5′

B5′ ATCGATCGATCGATCGATCGATCGATCG 3′

C3′ ATCGATCGATCGATCGATCGATCGATCG 5′

D5′ UAGCUAGCUAGCUAGCUAGCUAGC UAGC 3′

Answer key (B) & worked solution

Correct answer: Option B

5′ ATCGATCGATCGATCGATCGATCGATCG 3′

Q6ZoologyNEET UG PYQTools of Recombinant DNA Technology - Cloning Vectors

Plasmid pBR322 has a PstI restriction enzyme site within gene amp

^{R}

that confers ampicillin resistance. If this enzyme is used for inserting a gene for β-galactoside production and the recombinant plasmid is inserted in an E.coli strain

AIt will lead to lysis of the host cell

BIt will be able to produce a novel protein with dual ability

CIt will not be able to confer ampicillin resistance to the host cell

DThe transformed cells will have the ability to resist ampicillin as well as produce β-galactoside

Answer key (C) & worked solution

Correct answer: Option C

pBR322 is a commonly used cloning vector. When the gene for β-galactoside is inserted in the ampicillin resistance gene by using Pst I, the recombinant E.coli will lose ampicillin resistance due to insertional inactivation of the antibiotic resistance gene. The host (recombinant) cell will produce β-galactoside which is not a novel protein nor does it have the dual ability. The transformed cells cannot resist ampicillin as they have lost ampicillin resistance. A recombinant E. coli is produced and the host cell will not undergo lysis due to the insertion of the β-galactoside gene.