NEET BotanyUpdated 19 Oct 2026

Molecular Basis of Inheritance: NEET PYQs and weightage

Molecular Basis of Inheritance carries 9.1 of 100 Botany marks in NEET by past-paper share: 72 of the 793 tagged NEET Botany PYQs in the ViJEEta bank (NEET 2013–2026). It ranks 1 of 21 Botany chapters.

Take the 25-question Molecular Basis of Inheritance test Key facts ↓All NEET Botany chapters

9.1/100 Weight in Botany

Exam importance (5/5, by past-paper share)

72 NEET PYQs

588 Practice questions

493 With measured difficulty

How the weight is computed: this chapter's tagged NEET PYQs divided by all tagged NEET Botany PYQs in the bank (72 of 793), times 100, with repeated questions counted once. The bank does not store the year of each NEET question, so none is printed. Computed from the bank at build time. Updated 19 Oct 2026.

Molecular Basis of Inheritance: key facts for NEET

16 facts the paper keeps asking, each with how it is asked. Copy it onto one page of your notebook: that page is this chapter's handbook.

Double helix and Chargaff's rule
Watson & Crick proposed the double helix in 1953 using X-ray data from Wilkins & Franklin. Chargaff's rule says that in dsDNA, $\frac{A}{T} = \frac{G}{C} = 1$ .
Asked as: dsDNA has $20%$ cytosine. What $%$ is adenine? ( $30%$ )
Base pairing and helix dimensions
A pairs with T by 2 H-bonds and G pairs with C by 3, so a purine always faces a pyrimidine. The helix is right-handed, with pitch $3.4 nm$ , about $10$ bp per turn and $0.34 nm$ per bp.
Asked as: Find DNA length from bp ( $6.6 \times 1 0^{9} bp \times 0.34 nm \approx 2.2 m$ ), or find bp from length.
Histones, nucleosome and chromatin
Histones are basic proteins rich in lysine and arginine. Eight of them form an octamer, and DNA wraps around it to make a nucleosome of about $200$ bp ("beads-on-string" under EM). Euchromatin is loose, stains light and is active; heterochromatin is dense, stains dark and is inactive.
Asked as: Why histones are positive / which chromatin is transcriptionally active.
Griffith's transformation experiment
Griffith (1928) used Streptococcus pneumoniae. Heat-killed S (capsulated, virulent) mixed with live R killed the mice, and live S was recovered from them, which shows a "transforming principle". Avery, MacLeod & McCarty later showed that only DNase stops transformation.
Asked as: Which enzyme blocked transformation (DNase, not protease or RNase).
Hershey–Chase experiment
Hershey & Chase (1952) labelled phage DNA with $^{32} P$ and protein with $^{35} S$ . After blending and centrifuging, only the $^{32} P$ was found inside E. coli. This was the unequivocal proof that DNA is the genetic material.
Asked as: Which label ended up in the bacterial pellet.
RNA as genetic material
RNA is the genetic material in TMV and $Q β$ phage. The $2^{'}$ -OH makes RNA labile and fast-mutating, and thymine adds stability to DNA. RNA was the first genetic material, and DNA is better for storing information.
Asked as: Why DNA is more stable than RNA.
Semiconservative replication (Meselson & Stahl)
Meselson & Stahl (1958) grew E. coli in $^{15} N H_{4} Cl$ , moved it to $^{14} N$ , and used a $CsCl$ density gradient. Generation I ( $20$ min) was all hybrid; generation II ( $40$ min) was hybrid : light $= 1 : 1$ . Taylor showed the same in Vicia faba using radioactive thymidine.
Asked as: Hybrid : light ratio after $80$ min ( $1 : 7$ ).
DNA replication
DNA polymerase works only $5^{'} \to 3^{'}$ . Synthesis is continuous on the $3^{'} \to 5^{'}$ template and discontinuous on the $5^{'} \to 3^{'}$ template, and DNA ligase joins the fragments. E. coli replicates in $18$ min at about $2000$ bp/s, and dNTPs act as both substrate and energy source.
Asked as: Which enzyme joins the discontinuous fragments.
Transcription unit
A transcription unit has a promoter (upstream, at the $5^{'}$ end of the coding strand), a structural gene and a terminator. The $3^{'} \to 5^{'}$ strand is the template. In bacteria, RNA polymerase uses $σ$ to initiate and $ρ$ to terminate.
Asked as: Write the mRNA from a given coding-strand sequence.
Eukaryotic RNA polymerases and processing
In eukaryotes, RNA pol I makes 28S, 18S and 5.8S rRNA; pol II makes hnRNA; pol III makes tRNA, 5S rRNA and snRNA. hnRNA is then capped (methyl guanosine triphosphate at the $5^{'}$ end), tailed ( $200$ – $300$ adenylates at the $3^{'}$ end) and spliced (introns out).
Asked as: Match each RNA polymerase with its product.
Genetic code: discoverers and codon count
Genetic code: Gamow argued for a triplet ( $4^{3} = 64$ codons), Khorana synthesised RNA chemically, Nirenberg built a cell-free system, and Ochoa supplied polynucleotide phosphorylase. Of the $64$ codons, $61$ code for amino acids and $3$ are stops (UAA, UAG, UGA).
Asked as: Which scientist did what / number of sense codons.
Features of the genetic code
The code is degenerate, has no punctuation and is nearly universal, with exceptions in mitochondria and some protozoans. AUG codes for methionine and is also the start codon.
Asked as: Which feature means one amino acid has many codons (degeneracy).
Mutations and frameshift
In sickle cell anaemia, one base change in the $β$ -globin gene swaps glutamate for valine. Inserting or deleting $1$ or $2$ bases causes a frameshift; $3$ bases do not.
Asked as: Which insertion keeps the reading frame intact.
tRNA and translation
Crick predicted tRNA as the adapter; it was earlier called sRNA. Its secondary structure is a clover-leaf, its 3-D shape is an inverted L, and there is no tRNA for stop codons. Charging (aminoacylation) uses ATP, and 23S rRNA in bacteria is the ribozyme that forms peptide bonds. UTRs sit at both the $5^{'}$ and $3^{'}$ ends.
Asked as: Which molecule acts as the peptidyl-transferase ribozyme.
Lac operon
The lac operon (Jacob & Monod) has the i gene, which makes the repressor ("i" stands for inhibitor). The structural genes are z ( $β$ -galactosidase), y (permease) and a (transacetylase). Lactose or allolactose is the inducer, and repressor control is negative regulation.
Asked as: Match each gene with its product / why glucose cannot induce the operon.
Human Genome Project and DNA fingerprinting
HGP ran from 1990 to 2003. The human genome has $3164.7$ million bp and about $30, 000$ genes, and less than $2%$ of it codes for protein. Dystrophin is the largest gene ( $2.4$ million bases). Chromosome 1 has the most genes ( $2968$ ) and Y the fewest ( $231$ ). There are about $1.4$ million SNPs, and $99.9%$ of bases are the same in all humans. DNA fingerprinting (Alec Jeffreys) uses VNTR, a mini-satellite of $0.1$ – $20$ kb, detected by Southern blot.
Asked as: Match HGP numbers / the VNTR is which class of satellite DNA.

Trap

The coding strand (5'→3') is not copied. It has the same sequence as the mRNA, with T in place of U. The template strand (3'→5') is the one read, so the mRNA is complementary to the template, not to the coding strand.

How does NEET ask Molecular Basis of Inheritance?

8 real previous-year questions from this chapter, as printed in the paper, each with its worked solution. Answer the first one here with no sign-in.

Q1BotanyNEET UG PYQTranscription

Try right here · No sign-in

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows: 5′ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3′?

Answer key (B) & worked solution

Correct answer: Option B

5′ ATCGATCGATCGATCGATCGATCGATCG 3′

Q2BotanyNEET UG PYQProperties of Genetic Material (DNA Versus RNA)

Given below are two statements: Statement I: In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes, RNA acts as a genetic material and also as a catalyst for some important biochemical reactions in living systems. Being reactive, RNA is unstable. Statement II: DNA evolved from RNA and is a more stable genetic material. Its double helical strands being complementary, resist changes by evolving repairing mechanism. In the light of the above statements, choose the most appropriate answer from the options given below:

AStatement I is correct but statement II is incorrect

BStatement I is incorrect but statement II is correct

CBoth statement I and statement II are correct

DBoth statement I and statement II are incorrect

Answer key (C) & worked solution

Correct answer: Option C

The first statement correctly explains RNA being the first genetic material as well as being unstable due to its single stranded nature. The second statement is correct as well as DNA evolved from RNA as a more stable double stranded genetic material.

Q3BotanyNEET UG PYQThe Search for Genetic Material

Transformation was discovered by:

AHershey and Chase

BGriffith

CWatson and Crick

DMeselson and Stahl

Answer key (B) & worked solution

Correct answer: Option B

Transformation is the genetic alteration of a cell resulting from the direct uptake and incorporation of exogenous genetic material from its surroundings and taken up through the cell membrane. Transformation was first demonstrated in 1928 by British bacteriologist Frederick Griffith.

Q4BotanyNEET UG PYQTranslation

A complex of ribosome attached to a single strand of RNA is known as

APolysome

BPolymer

CPolypeptide

DOkazaki fragment

Answer key (A) & worked solution

Correct answer: Option A

Large clusters of 10 to 100 ribosomes, actively translating protein synthesis are called polysomes. The ribosomes in a polysome are connected by a single molecule of mRNA that is being translated simultaneously by many closely spaced ribosomes. Polymers are large molecules composed of many monomer units. Polypeptide is a large linear polymer of amino acids bonded together by peptide linkage. Okazaki fragments are small nucleic acid fragments formed by discontinuous replication of lagging strand during DNA replication and are later joined together by DNA ligase enzyme.

Q5BotanyNEET UG PYQTranscription

Match List I with List II. List IList IIA. RNA polymerase IIII. snRNP’sB. Termination of transcriptionII. PromotorC. Splicing of ExonsIII. Rho factorD. TATA boxIV. SnRNAs, tRNA Choose the correct answer from the options given below.

AA-III, B-II, C-IV, D-I

BA-III, B-IV, C-I, D-II

CA-IV, B-III, C-I, D-II

DA-II, B-IV, C-I, D-III

Answer key (C) & worked solution

Correct answer: Option C

• the RNA polymerase III is responsible for transcription of tRNA, 5srRNA, and snRNAs (small nuclear RNAs) • The RNA polymerase is only capable of catalysing the process of elongation. It associates transiently with initiation-factor (σ) and termination-factor (ρ) to initiate and terminate the transcription, respectively. Association with these factors alter the specificity of the RNA polymerase to either initiate or termina • promoter lies upstream of and slightly overlaps with the transcriptional start site (+1). It contains a TATA box, which has a sequence (on the coding strand) of 5'-TATAAA-3'.

Q6BotanyNEET UG PYQDNA Replication

The experimental proof for semiconservative replication of DNA was first shown in a

APlant

BBacterium

CFungus

DVirus

Answer key (B) & worked solution

Correct answer: Option B

Semi-conservative DNA replication was proved by Matthew Meselson and Franklin Stahl by their experiment in the bacterium Escherichia coli.

Q7BotanyNEET UG PYQDNA

Expressed Sequence Tags (ESTs) refers to

APolypeptide expression

BDNA polymorphism

CNovel DNA sequences

DGenes expressed as RNA

Answer key (D) & worked solution

Correct answer: Option D

Expressed Sequence Tags (ESTs) are DNA sequences (genes) that are expressed as mRNA for protein synthesis. These are used in the Human Genome Project.

Q8BotanyNEET UG PYQDNA

Which of the following statements are correct with reference to packaging of DNA helix ? A. Histones are organized to form a unit of eight molecules called histone octamer. B. Histones are negatively charged basic proteins. C. Histones are rich in the basic amino acid residues - lysine and arginine. D. The positively charged DNA is wrapped around the histone octamer to form nucleosome. E. The packaging of chromatin at higher levels requires an additional set of proteins called non-histone chromosomal proteins.

Choose the correct answer from the options given below :

AA, B and D only

BA, C and E only

CC, D and E only

DB, D and E only

Answer key (B) & worked solution

Correct answer: Option B

Eight Histones are combined to form a histone octamer. Histones are positively charged basic proteins that are rich in basic amino acids (lysine and arginine). The negatively charged DNA is wrapped around the histone octamer to form nucleosome. The packaging of chromatin at higher levels require NHC (non histone chromosomal) proteins.

Which topics in Molecular Basis of Inheritance carry the most questions?

The 12 busiest of 13 topics, by tagged PYQs, then practice questions. Counted from the bank. Updated 19 Oct 2026.

Topic	PYQs	Practice questions
Transcription	19	66
DNA	14	123
Regulation of Gene Expression	8	52
Genetic Code	6	100
The Search for Genetic Material	6	31
DNA Replication	5	74
Translation	4	41
DNA Fingerprinting	3	30
Human Genome Project	3	25
RNA World	2	16
Properties of Genetic Material (DNA Versus RNA)	1	12
Post-Transcriptional Modifications	1	8

Why does Molecular Basis of Inheritance show "–" until you answer 3 questions?

Unknown is not zero. Until you answer at least 3 graded questions in Molecular Basis of Inheritance, ViJEEta shows – instead of a zero or a 50% default. Book exercises can raise chapter mastery up to 0.60, adaptive practice up to 0.75, and only a timed chapter test or mock can certify 0.80 and above.

How ViJEEta scores you

What happens when you test Molecular Basis of Inheritance?

Every chapter test is 25 questions. It starts at moderate difficulty and adapts after each saved answer. If you open a solution before answering, that attempt earns no credit, so your mastery stays honest.

Start the Molecular Basis of Inheritance test

Chapters either side of Molecular Basis of Inheritance by weight

Cell: The Unit of Life Weight 8.1/100 Morphology of Flowering Plants Weight 7.9/100

Molecular Basis of Inheritance: NEET PYQs and weightage

Molecular Basis of Inheritance: key facts for NEET

Double helix and Chargaff's rule

Base pairing and helix dimensions

Histones, nucleosome and chromatin

Griffith's transformation experiment

Hershey–Chase experiment

RNA as genetic material

Semiconservative replication (Meselson & Stahl)

DNA replication

Transcription unit

Eukaryotic RNA polymerases and processing

Genetic code: discoverers and codon count

Features of the genetic code

Mutations and frameshift

tRNA and translation

Lac operon

Human Genome Project and DNA fingerprinting

How does NEET ask Molecular Basis of Inheritance?

Which topics in Molecular Basis of Inheritance carry the most questions?

Why does Molecular Basis of Inheritance show "–" until you answer 3 questions?

What happens when you test Molecular Basis of Inheritance?

Chapters either side of Molecular Basis of Inheritance by weight